My Account: Log In | Join | Renew
Search
Author
Title
Vol.
Issue
Year
1st Page

The Plant Genome - Article

 

 

This article in TPG

  1. Vol. 4 No. 3, p. 283-299
    OPEN ACCESS
     
    Received: May 27, 2011
    Published: Nov, 2011


    * Corresponding author(s): rpwise@iastate.edu
 View
 Download
 Alerts
 Permissions
 Share

doi:10.3835/plantgenome2011.05.0017

Rf8-Mediated T-urf13 Transcript Accumulation Coincides with a Pentatricopeptide Repeat Cluster on Maize Chromosome 2L

  1. Julie Meyer,
  2. Deqing Pei and
  3. Roger P. Wise 
  1. J. Meyer, D. Pei, and R.P. Wise, Interdepartmental Genetics Program, Iowa State Univ., Ames, IA 50011; and Department of Plant Pathology and Microbiology, Iowa State Univ., Ames, IA 50011; J. Meyer, present address: Regulatory Sciences Product Characterization Center, Monsanto, St. Louis, MO 63167; D. Pei, present address: Dep. of Biostatistics, St. Jude's Children Research Hospital, Memphis, TN 38105; R.P. Wise, USDA-ARS, Crop and Insect Genetics, Genomics, and Informatics Research Unit, Iowa State Univ., Ames, IA 50011

Abstract

Cytoplasmic male sterility (CMS) is a maternally inherited inability to produce functional pollen. In Texas (T)-cytoplasm maize (Zea mays L.), CMS results from the action of the URF13 mitochondrial pore-forming protein encoded by the unique T-urf13 mitochondrial gene. Full or partial restoration of fertility to T-cytoplasm maize is mediated by the Rf2a nuclear gene in combination with one of three other genes: Rf1, Rf8, or Rf*. Rf2a encodes a mitochondrial aldehyde dehydrogenase whereas Rf1, Rf8, and Rf* are associated with the accumulation of distinctive T-urf13 mitochondrial transcripts. Rf8-associated RNA processing activity was mapped to a 4.55-Mbp region on chromosome 2L that contains 10 pentatricopeptide repeat (PPR) encoding genes in the B73 5b.60 genome assembly. Genetic linkage analysis also indicated that Rf* is positioned within this PPR cluster as well as Rf3, which restores USDA (S)-cytoplasm maize. Partially male-fertile plants segregated for the presence or absence of the Rf8-associated T-urf13 1.42- and 0.42-kbp transcripts, indicating that the RNA processing event associated with these transcripts is not necessary for anther exsertion. In addition, a statistically significant delay in flowering was observed between partially male-fertile and mostly male-fertile plants. Taken together, these new results indicate that Rf8-mediated male fertility is under the control of more than one nuclear locus.


Abbreviations

    AFLP, amplified fragment length polymorphism; ALDH, aldehyde dehydrogenase; BSA-AFLP, bulk segregant analysis amplified fragment length polymorphism; BT, Boro II; CAPS, cleaved amplified polymorphic sequence; CMS, cytoplasmic male sterility; cms-S, S-cytoplasm maize; cms-T, T-cytoplasm maize; CTAB, hexadecyltri-methylammonium bromide, DAPFF, days after planting to the first flowering; EDTA, ethylenediaminetetraacetic acid; HL, Honglian; mRNA, messenger RNA; N, normal; PCR, polymerase chain reaction; PPR, pentatricopeptide repeat; RAPD, random amplified polymorphic DNA; Rf, restorer of fertility; RFLP, restriction fragment length polymorphism; S, USDA; SDS, sodium dodecyl sulfate; SSPE, saline sodium phosphate EDTA; T, Texas; TPR, tetratricopeptide repeat; UTR, untranslated region

Cytoplasmic male sterility (CMS) is caused by a maternally inherited inability to produce functional pollen. In maize (Zea mays L.), there are three types of CMS, USDA (S), Charrua (C), and Texas (T) (Beckett, 1971). Male sterility in T-cytoplasm maize (designated cms-T) results from the action of a T-cytoplasm specific mitochondrial gene, T-urf13 (Dewey et al., 1987; Wise et al., 1987b). This gene encodes 13 kDa monomers, which are assembled as tetrameric pore-forming structures that span the inner mitochondrial membrane (Korth et al., 1991; Rhoads et al., 1994). The presence of the 13 kDa URF13 protein also confers sensitivity to long-chain β-polyketol toxins produced by race T of the ascomycete fungus Cochliobolus heterostrophus (asexual stage Bipolaris maydis), the casual agent of southern corn leaf blight (Kono and Daly, 1979; Kono et al., 1980).

The presence of specific nuclear genes mediates the restoration of male fertility to CMS plants. In T cytoplasm, this is accomplished by the combined action of Rf1 and Rf2a (Wise et al., 1999a). Rf1 mediates a series of mitochondrial transcript processing events, resulting in the accumulation of additional 1.6- and 0.6-kbp T-urf13 transcripts (Dewey et al., 1987; Wise et al., 1996) whereas Rf2a is an aldehyde dehydrogenase and is not involved in transcript processing (Cui et al., 1996; Liu et al., 2001). Two additional genes, Rf8 and Rf*, restore partial fertility when they, like Rf1, are combined with Rf2a (Dill et al., 1997). However, Rf8 and Rf* mediate the accumulation of additional 1.42- and 0.42-kpb transcripts as well as 1.4- and 0.4-kbp T-urf13 transcripts, respectively (Dill et al., 1997).

Of the five species with cloned restorer of fertility (Rf) genes, four encode pentatricopeptide repeat (PPR) proteins (Akagi et al., 2004; Bentolila et al., 2002; Klein et al., 2005; Koizuka et al., 2003). Pentatricopeptide repeat proteins are RNA binding proteins that are predominantly localized to mitochondria and chloroplasts with functions in editing, stabilization, and cleavage (Lurin et al., 2004; Small and Peeters, 2000). The cloned Rf genes of radish (Raphanus sativus L.), rice (Oryza sativa L.), and petunia [Petunia ×atkinsiana (Sweet) D. Don ex W. H. Baxter [= P. axillaris × P. integrifolia] (syn. Petunia hybrida L.)] are present in clusters of PPR-encoding genes with one functional gene and multiple pseudogenes suggesting recent gene duplication (Akagi et al., 2004; Bentolila et al., 2002; Brown et al., 2003; Desloire et al., 2003; Komori et al., 2003). Three of the restorer genes in sorghum [Sorghum bicolor (L.) Moench] reside in PPR clusters that share similarity to rice OsRf1 (Klein et al., 2005; Jordan et al., 2011). Because Rf1, Rf8, and Rf* are associated with the additional accumulation of T-urf13 transcripts, the possibility exists that they encode PPR proteins as well.

Analogous to T-urf13, the mitochondrial gene region encompassing orf355 and orf77 is responsible for male sterility in S-cytoplasm maize (cms-S) (Zabala et al., 1997). Likewise, cms-S utilizes the nuclear gene Rf3 to restore fertility to male-sterile plants. Rf3 cosegregates with a novel orf355 and orf77 transcript accumulation, suggesting an RNA editing function (Wen and Chase, 1999). The rf3 locus was mapped to maize chromosome 2L by Laughnan and Gabay (1978) by translocation and inversion heterozygotes. Kamps and Chase (1997) placed rf3 4.3 cM distal to restriction fragment length polymorphism (RFLP) whp1 and 6.4 cM proximal to RFLP bnl7.14. Shi et al. (1997) mapped rf3 4.8 cM distal to RFLP umc49 and 2.7 cM proximal to a random amplified polymorphic DNA (RAPD) marker, E08-1.2. Zhang et al. (2006) placed rf3 2.4 cM distal to a cleaved amplified polymorphic sequence (CAPS) marker and 1.8 cM proximal to a sequence characterized amplified region (SCAR) marker. Ultimately, Xu et al. (2009) observed cosegregation of Rf3-mediated fertility with three PPR-encoding genes on chromosome 2L in 900 segregating individuals.

While Rf1 and Rf2a have been genetically mapped to chromosomes 3 and 9, respectively (Schnable and Wise, 1994), the position of Rf8 has not yet been reported. To understand T cytoplasm in greater detail, the sequence and function of the rf8 locus needs to be elucidated. These experiments describe the high-resolution mapping of the rf8 locus to a 4.55-Mbp region on chromosome 2L, positioned within bacterial artificial chromosome contig 108 of MaizeSequence release 5b.60 (Ware et al., 2011). This region harbors 10 PPR-encoding genes, including candidates for the cms-S restorer, Rf3. Plants restored to partial fertility segregated independently of the Rf8-associated 1.42- and 0.42-kbp transcripts, suggesting the possibility of additional factors affecting pollen exsertion in the genome.


MATERIALS AND METHODS

Maize Nomenclature

Loci and recessive alleles are designated by lowercase symbols, and dominant alleles are designated by uppercase symbols; for example, the rf8 allele of the rf8 locus is recessive to the Rf8 allele. Lines that carry T cytoplasm (sterile or fertile) are referred to as T-cytoplasm lines. Male-sterile lines that carry T cytoplasm are designated cms-T. Restored T cytoplasm designates lines restored to fertility via the presence of nuclear restorer genes. Except in rare circumstances, normal (N) -cytoplasm lines are male fertile.

General Mapping Strategy

Rf8 and Rf1 have similar molecular phenotypes. Both genes are associated with additional accumulation of T-urf13 transcripts, and both are reported to restore at least some fertility to T-cytoplasm plants (Dill et al., 1997; Wise et al., 1996). Both genes are also associated with decreased accumulation of URF13 (Dewey et al., 1987; Dill et al., 1997). The Rf8-mediated URF13 reduction is less pronounced in ears than tassels whereas the Rf1-mediated reduction occurs equally in ears and tassels (Dill et al., 1997; Wise et al., 1987a). Because Rf8-associated anther exsertion is environmentally sensitive, the most reliable way to assay the plants for Rf8-associated T-urf13 accumulation is to determine if the 1.42- and 0.42-kbp transcripts are present via RNA gel blot analysis.

Development of Plant Material

Normal (N) W64A (rf1/rf1, Rf2/Rf2, rf8/rf8) and (N) wx1-m8 (rf1/rf1, Rf2/Rf2, Rf8/Rf8) were the two primary inbred lines used in this study. The original Rf8 allele, Rf8-8703, originated from plant number 90 8703 (rf1/rf1, Rf2/rf2, Rf8/rf8) (Schnable and Wise, 1994). It was identified by its sterile phenotype in a 1990 screen for rf2 mutants and was fertilized with pollen from our wx1-m8 stock (rf1/rf1, Rf2/Rf2, Rf8/rf8). Partially fertile plants (90 g 1138-5 and -6; Table 4 in Schnable and Wise, 1994) derived from this cross that were homozygous for Rf2 (rf1/rf1, Rf2/Rf2, Rf8/rf8) were self pollinated; subsequent progeny derived from these plants via self pollinations or outcrosses are designated as being derived from the 8703 pedigree (Dill et al., 1997). The Rf* allele originated from the rf1-m7212 pedigree in a screen for rf1 mutants wherein a novel 1.4-kbp T-urf13 transcript was identified as being mediated by Rf* (Fig. 5 in Wise et al., 1996; Fig. 3 and Table 6 in Dill et al., 1997).

As illustrated in Fig. 1, our initial population consisted of progeny derived from a single cross, (T) Rf8-8703/rf8-W64A × (N) rf8-W64A/rf8-W64A BC2, grown in the 1997 summer nursery at the Iowa State University Curtiss Research Farm in Ames, IA. One hundred seventeen segregating individuals were crossed by (N) rf8-W64A/rf8-W64A and second (unfertilized) ears were collected from each for DNA and RNA extractions. Ten plants from this 1997 population that possessed the T-urf13-derived 1.42- and 0.42-kbp transcripts were interpreted as harboring the Rf8 allele (genotype Rf8-8703/rf8-W64A), and thus crosses derived from them were selected to create the 2008 high-resolution BC3 population. This population was also grown at the Curtiss Research Farm in 2008. Young leaf tissue was collected from 1731 individuals for DNA extractions and fertility phenotypes were recorded from adult plants. Tissue for total RNA extractions was collected from immature second ears from 952 individuals and 1584 plants were crossed by (N) rf8-W64A/rf8-W64A.

Figure 1.
Figure 1.

Pedigree of Rf8. Each box represents a cross. Plants were either backcrossed to (normal [N]) W64A (rf1/rf1, Rf2/Rf2, rf8/rf8) or test crossed to (N) wx1-m8 (rf1/rf1, Rf2/Rf2, Rf8/Rf8). Transcripts associated with Rf8 were identified from the 1994 generation. The 1997 mapping population is a BC3 generated from one cross. The 2008 mapping population is a BC4 generation and is generated from 10 1997 individuals possessing the Rf8-associated 1.42-kbp transcripts. Plants grown for fertility observation in 2009 are progeny from crosses BC6, BC5TC1, BC4 (2008 cross only), BC6TC1, BC5TC2, BC7TC1, and BC6TC2. T, Texas.

 

Observation of Fertility Phenotypes (Anther Exsertion)

Male fertility was scored based on the four category system—S, sterile; “S,” partially fertile; “F,” mostly fertile; F, fertile—as described in Schnable and Wise (1994). Sterile indicates no anther exsertion, partially fertile indicates >0 but <50% of the anthers on the tassel exserted, mostly fertile indicates >50 but <100% of the anthers exserted, and fertile indicates 100% of the anthers exserted. The 2008 field was observed for fertility every day for 17 consecutive days, starting at the beginning of flowering (4 Aug. 2008) and ending 3 d after anther exsertion from the last plant (20 Aug. 2008).

Plants containing an Rf8 allele appear to lose fertility with increasing numbers of backcrosses to (N) W64A. To account for this observation, plants with successive amounts of backcrossing to (N) W64A and test crossing to (N) wx1-m8 were grown in 2009 at Curtiss Research Farm and are illustrated in Fig. 1. The origin of the wx1-m8 stock is described in detail in Wise and Schnable (1994). Sixty progeny each from five crosses, BC5TC1, BC4 (2008 cross only), BC6TC1, BC5TC2, and BC6TC2, were grown. Fertility observations and leaf tissue for DNA analysis were collected from all plants. A subset of plants was tested for fertility by crossing as males onto (T) W64A or (N) wx1-m8. Pollen was tested from each genotype that flowered and all plants tested produced kernels.

DNA Isolation and Analysis

For the 1997 mapping population, DNA was extracted using a 1 g hexadecyltri-methylammonium bromide (CTAB) extraction (Wise et al., 1996). One hundred seventeen individuals were subjected to bulk segregant analysis amplified fragment length polymorphism (BSA-AFLP) analysis as described by Wei et al. (1999).

For the 2008 mapping population, isolation of DNA was performed using a modified 96-well CTAB extraction (Dietrich et al., 2002). Polymerase chain reaction (PCR) primers were designed from the filtered gene set at MaizeSequence (Ware et al., 2011; Schnable et al., 2009) to amplify introns or 3′ untranslated regions (UTRs) from linked genes (see Table 1). Primers were designed to be codominant markers, CAPS markers, or size polymorphic markers. Polymerase chain reaction conditions were 3 min at 95°C, 30 sec at 95°C, 30 sec at melting temperature, 1.5 min at 72°C, 40 cycles, 10 min for 72°C, and then hold at 4°C.


View Full Table | Close Full ViewTable 1.

List of Rf8 mapping primers.

 
Marker Located in gene Marker type Primer sequence (5′-3′) Restriction enzyme Tm
76755p2 GRMZM2G527387 Codominant TGAAGAAATGGTGATGCGAGC / ACAGATGGCACTCCTGATGTGTC 56
135087p1 GRMZM2G135087 Size polymorphism TGGAATACTTGCTTCTTGCTTGG / CAATGGTTATGCGTGAACGGG 56
144635p4 GRMZM2G144635 Codominant TTGTGCTTGGGCTTTTCACG / CCTGACTTCCTGCTTTTGTATCGC 54
66902p1 GRMZM2G066902 Codominant CGCTAACGCTTTCCTCTTGGAC / CTGTTCCCCATCCTTTCTACATC 56
csu811_p9 AC217293.3_FGT007 Codominant CGAGGTCGAATCAAATTCTTCC / GTACGGGCGGTTAAAGAAAC 56
J04p6 GRMZM2G108171 Size polymorphism CAAAGTCTCTGTCACTGTCACCTGG / TCTTCTTCCTCCTCCCTTGGAC 60
J04p8 GRMZM2G108171 Size polymorphism TTAGTTGATTAGAGGAGGTTGCGG / GTCATTTAGCGTTTAGCGTCCAAG 60
18p4 GRMZM2G092284 CAPS marker AAGATCATTCGGCGCGAGAA / CGGAGCCAAAACATGTGAAA MseI 56
87p2 GRMZM2G035807 CAPS marker ACATTGGTCTTTGTGGAGAC / TTCACACCCAACAGGTTGAC DraI 56
10p2 GRMZM2G149935 CAPS marker CGTAATGAAATGCGACGACG / CGTAGCCAGGTCCATTAGCA MseI 56
26p3 GRMZM2G147819 CAPS marker AGTTAAGGCTATCAGAATGA / ACTGACGATCAAATCTGATC ApoI 56
umc36_p10 GRMZM2G059033 Codominant CCTGGTGCACCATGTGATAGTTT / TTACCATGCCAATGGAATTG 56
Marker names are based on the predicted gene they are designed from on MaizeSequence release 5b.60 (Ware et al., 2011; Schnable et al., 2009).
Genes are from the filtered gene set from MaizeSequence release 5b.60 (Ware et al., 2011).
§Tm, melting temperature.
CAPS, cleaved amplified polymorphic sequence.

To efficiently screen the large 2008 mapping population, PCR primers were derived from the RFLP markers used in the 1997 mapping study. Overgo sequences were located at MaizeGDB (Lawrence et al., 2008) for the csu811 and umc36 RFLPs. These sequences were blasted against the maize genome using MaizeSequence release 5b.60 (Ware et al., 2011; Schnable et al., 2009). These overgos aligned to two genes on 2L (see Table 1). From these genes, PCR primers were designed to amplify interior portions of these genes.

RNA Isolation and Analysis

Total RNA was isolated from one gram of frozen second immature ear tissue via a Trizol-like reagent: 38% saturated phenol pH 4.3, 1 M guanidine thiocyanate, 1 M ammonium thiocyanate, 0.1 M sodium acetate pH 5.0, and 5% glycerol (Caldo et al., 2004). Eight micrograms of RNA were denatured with glyoxal (Ambion, Austin, TX) and size fractionated on a 1.8% SeaKem GTG agarose gel (FMC, Rockland, ME) with 0.01 M iodoacetic acid (Sigma, St. Louis, MO) for 14 h at 4°C. The gel and the circulating running buffer was 10 mmol Na2HPO4 pH 7.0. Ribonucleic acid was transferred to Hybond XL membranes (GE Healthcare/Amersham Biosciences, Piscataway, NJ) for 4 h using 20x saline-sodium citrate (SSC) (3 M NaCl and 0.3 M sodium citrate, pH 7.0) as a transfer buffer and crosslinked with 220 MJ of ultraviolet light emitted by 312 nm bulbs in a Stratalinker 2400 (Stratagene, La Jolla, CA) followed by baking at 80°C for 1 h. The fixed RNA was de-glyoxylated by treating the membrane in 20 mmol Tris-Cl pH 8.0 at 65°C for 30 min. The T-urf13 derived T-st308 DNA probe (Wise et al., 1996) was used for hybridization. Probe DNA was random primed with α-32P deoxycytidine triphosphate (dCTP) (PerkinElmer, Waltham, MA) (Feinberg and Vogelstein, 1983). Hybridization was performed for 18 h at 65°C in 7% sodium dodecyl sulfate (SDS), 1% bovine serum albumin, 1 mmol Na2 ethylenediaminetetraacetic acid (EDTA), and 0.5 M NaHPO4, pH 7.2 (Church and Gilbert, 1984). Membranes were incubated at 65°C in 1x saline sodium phosphate EDTA (SSPE), 0.1% SDS (20x SSPE contains 0.2 M monobasic sodium phosphate, 3.6 M NaCl, and 20 mmol EDTA, pH 7.4) for two 30 min washes followed by a 1 h wash. A more stringent wash in 0.1x SSPE, and 0.1% SDS was done for 15 to 20 min and membranes were exposed to CL-XPosure film (Thermo Scientific, Rockford, IL) for 1 to 10 d at −80°C using two Dupont Cronex Lightning Plus intensifying screens (Sigma, St. Louis, MO).


Results

The rf8 Locus Maps to Maize Chromosome 2L

To position the gene encoding Rf8-associated T-urf13 transcript accumulation on the maize genetic map, DNA from 117 individuals from the 1997 mapping population were tested for Rf8-associated transcripts via RNA gel blot analyses. This information was utilized in the design of a BSA-AFLP strategy (see Methods). Two hundred fifty-six pairwise combinations of EcoRI and MseI primers were tested on the mapping parents, (T) Rf8-8703/rf8-W64A and (N) rf8-W64A/rf8-W64A, and two contrasting DNA pools, one representing 16 progeny displaying the T-urf13-derived 1.42- and 0.42-kbp transcripts and the other representing 16 progeny without the 1.42- and 0.42-kbp transcripts. Three hundred twenty-five polymorphisms were found with 20 conserved between the mapping parents. Of these, three polymorphic amplified fragment length polymorphisms (AFLPs) confirmed linkage to the locus mediating Rf8-associated T-urf13 transcript accumulation. Sequence tagged site markers were designed from these cloned AFLP fragments (Yu and Wise, 2000) and one, designated ias21, displayed a polymorphism between the T232 and CM37 parents of the Brookhaven mapping population (Burr et al., 1988). The ias21 forward and reverse primers, 5′-TGCCACACTTTATCTAAGGTT-3′ and 5′-TTGCTTTTGCGACAACGACGA-3′, respectively, corresponding to Arf8.3 (E-AGA and M-CTA) AFLP, were used to amplify a DNA fragment that cosegregated in the Brookhaven low-resolution mapping population with whp1 (white pollen 1) on 2L. Restriction fragment length polymorphism markers linked to whp1 were also tested and csu811 and umc36 cosegregated closely with Rf8.

Positioning the rf8 locus on the Maize Genome Sequence

Results derived from the 1997 BC2 mapping population indicated that the gene mediating the accumulation of the additional 1.42- and 0.42-kbp T-urf13 transcripts is closely linked to the csu811 and umc36 RFLPs near whp1 on 2L (Pei, 2000). To further characterize the rf8 locus and take advantage of the newly sequenced maize genome (Schnable et al., 2009), progeny from 10 1997 BC3 crosses were used to create a large 2008 BC3 mapping population. Restriction fragment length polymorphism markers csu811 and umc36 were converted into the PCR markers csu811_p9 and umc36_p10 by amplifying the gene associated with the RFLP (see Table 1).

Two hundred fifty-three primer pairs were designed to amplify 3′ UTRs and introns of genes in the region from whp1 to umc36. Amplicons derived from these primers were screened against (N) wx1-m8 and (N) W64A for size polymorphisms. Cleaved amplified polymorphic sequence markers were developed from the sequence of monomorphic amplicons of the parents and a small subset of segregants. This facilitated the identification of informative single nucleotide polymorphisms that differentiate the wx1-m8 and W64A parents present in the mapping population (Table 1). These CAPS and size-polymorphic markers were screened against the 2008 BC3 population, and RNA gel blot analysis was used to determine the accumulation of the 1.42- and 0.42-kbp T-urf13 transcripts for recombinant individuals in the region from whp1 to umc36 recombinant individuals (see Fig. 2 and Table 2). Based on these analyses, the rf8 locus (i.e., specifying the accumulation of the 1.42- and 0.42-kbp T-urf13 transcripts) resides between polymorphic markers 76755p2 and 135087p1, which corresponds to a 4.55-Mbp region within B73 contig 108 (Fig. 2 and 3; MaizeSequence release 5b.60 [Ware et al., 2011]).

Figure 2.
Figure 2.

wx1-m8 × W64A genetic map, B73 physical map, and candidate genes in the flanking region. Rf8 is located between polymerase chain reaction markers 76755p2 and 135087p1 on chromosome 2L corresponding to contig 108. Interval distances in the genetic map are in centimorgans and interval distances in the physical maps are in megabase pairs. Positions of primers and names of genes are taken from MaizeSequence release 5b.60 (Ware et al., 2011; Schnable et al., 2009). The flanking region contains 10 pentatricopeptide repeat genes (designated ‡) and one pre-messenger RNA (mRNA) processing gene (designated †).

 
Figure 3.
Figure 3.

Polymerase chain reaction (PCR) markers illustrating the Rf8 flanking region. Panel A contains marker 76755p2, panel B contains 135087p1, and panel C contains 144635p4. Lanes 1 and 2 display the polymorphism between the mapping parents of the 2008 mapping population. Lanes 3 through 14 represent a subset of the segregating 2008 progeny in order of recombination breakpoint. Lanes 3, 4, and 9 through 12 demonstrate the absence of the Rf8-associated 1.42-kbp transcript while lanes 5 through 8, 13, and 14 display the presence of the 1.42-kbp transcript. Lanes 4 and 13 display a recombination breakpoint on the distal side of the 1.42-kbp transcript while lanes 5 through 12 display a recombination breakpoint on the proximal side of the 1.42-kbp transcript. N, normal; T, Texas.

 

View Full Table | Close Full ViewTable 2.

Comparison of genetic and physical distances among polymerase chain reaction (PCR) markers flanking the rf8 locus.

 
Interval Number of plants tested Confirmed informative recombinants Maximum no. recombinants Genetic distance B73 physical size kbp:cM ratio
76755p2 to 135087p1 616 31 71 8.25 ± 3.25 4.55 Mbp 552
76755p2 to Rf8 607 28 66 7.14 ± 3.13
Rf8 to 135087p1 702 2 50 3.70 ± 3.42
135087p1 to 144635p4 701 1 54 3.92 ± 3.78 0.81 Mbp 207
144635p4 to 66902p1 700 22 75 6.93 ± 3.79 1.99 Mbp 287
66902p1 to csu811_p9 1141 22 30 2.28 ± 0.35 0.85 Mbp 371
csu811_p9 to umc36_p10 1106 40 43 3.75 ± 0.14 1.00 Mbp 268
Genetic distances are averages of the minimum and maximum amount of recombination possible for a given region. The minimum was calculated based on confirmed informative recombinants. The maximum reflects unresolved but possible crossover locations.
Corresponding B73 physical size taken from MaizeSequence release 5b.60 (Ware et al., 2011; Schnable et al., 2009).

Candidate Gene Analysis

As shown in Table 3, the rf8 flanking region between the 76755p2 and 135087p1 contains 4.55 Mbp and 146 genes from the B73 filtered gene set. This region also contains PPR-encoding genes that cosegregated perfectly with 900 segregating individuals in an Rf3 S-cytoplasm mapping population (Xu et al., 2009). There are a total of sixteen genes of interest in the 4.55 Mbp Rf8-flanking region (Table 3). Ten of these are PPR-encoding genes, one is a tetratricopeptide repeat (TPR)-encoding gene, four genes have only one 35 amino acid PPR repeat, and one is a pre-messenger RNA (mRNA) processing gene. The PPR-encoding genes fall into four subclusters on 2L (Fig. 2). Subcluster 1 spans 24 kbp and contains two genes: one PPR encoding gene and one TPR encoding gene. Subcluster 2 spans 232 kbp and harbors two PPR-encoding genes and one gene containing a single PPR. Subcluster 3 spans 123 kbp and contains five PPR-encoding genes and two genes containing a single PPR. Subcluster 4 spans 82 kbp and contains two PPR-encoding genes and one gene containing a single PPR. It is important to note that the architecture of the region is likely not the same for all inbred lines and genetic backgrounds. Thus, the possibility exists that the wx1-m8 background has a different structure for this PPR cluster.


View Full Table | Close Full ViewTable 3.

Annotated genes in the rf8 flanking region.

 
Gene Predicted function Sequence coordinates
GRMZM2G527387 Unknown and/or sodium symporter 223,510,475–223,522,044
GRMZM2G130379 Unknown and/or GPCR 223,587,853–223,589,462
GRMZM2G410567 GH3 auxin-responsive promoter 223,632,037–223,638,458
GRMZM2G322844 Natural resistance-associated macrophage protein 223,721,037–223,727,516
GRMZM2G027001 Unknown 223,777,974–223,778,971
GRMZM2G027130 Chalcone synthase 223,791,790–223,793,218
GRMZM2G056088 Unknown 223,795,555–223,799,946
GRMZM2G151336 Unknown 223,869,955–223,872,859
GRMZM2G151227 whp1 Thiolase and/or chalcone synthase 223,888,706–223,892,691
GRMZM2G003043 Cyclin-like 223,975,596–223,982,847
GRMZM5G891855 Unknown 224,015,038–224,047,387
GRMZM2G166776 Unknown and/or antifreeze 224,064,456–224,065,350
GRMZM2G166718 Unknown and/or antifreeze 224,106,079–224,107,632
GRMZM2G166674 Unknown 224,135,400–224,136,784
GRMZM5G862594 Unknown 224,138,778–224,140,145
GRMZM2G166661 Unknown 224,145,708–224,147,676
GRMZM2G173377 Unknown 224,174,093–224,175,094
GRMZM2G065144 Ferric reductase 224,236,806–224,242,062
GRMZM2G169095 Peptidase M24 224,332,394–224,344,331
GRMZM2G358619 Ferric reductase 224,384,678–224,390,935
GRMZM2G358633 Unknown 224,412,145–224,414,871
GRMZM2G037993 Ferric reductase 224,463,082–224,467,568
GRMZM2G038024 Unknown 224,468,664–224,469,629
GRMZM2G414114 TCP transcription factor 224,523,636–224,527,847
GRMZM2G114948 Unknown and/or DUF247 224,536,161–224,537,608
GRMZM2G023328 Tropomyosin 224,546,497–224,547,584
GRMZM2G023585 Unknown 224,552,623–224,554,444
GRMZM2G105317 Histone fold 224,591,447–224,595,385
GRMZM2G097034 Unknown 224,624,457–224,624,678
GRMZM2G455945 Unknown 224,659,107–224,672,723
GRMZM2G703399 Unknown 224,699,998–224,700,520
GRMZM2G097896 Patatin and/or storage protein 224,734,195–224,741,296
GRMZM2G064475 Unknown 224,807,457–224,820,942
GRMZM2G064366 Unknown 224,831,235–224,839,536
GRMZM2G089625 Unknown 224,847,792–224,848,164
GRMZM2G301399 Unknown 224,851,546–224,852,841
GRMZM2G408768 14-3-3 protein binding domain 224,904,656–224,907,978
GRMZM2G107945 Galactose oxidase-like 224,908,574–224,912,937
GRMZM2G107931 Unknown 224,914,975–224,915,737
GRMZM2G107922 Unknown 224,931,792–224,932,515
GRMZM5G812796 Unknown 224,947,849–224,948,433
GRMZM2G367348 CAP 224,982,658–224,983,164
GRMZM2G066546 Unknown 224,988,216–224,988,793
GRMZM2G082799 Unknown 224,992,866–224,993,391
GRMZM2G082785 Unknown 224,995,417–224,996,267
GRMZM2G057056 MAF and/or putative inhibitor of septum formation 225,019,032–225,020,646
GRMZM2G355940 Peptide chain release factors 225,023,880–225,033,407
GRMZM2G056977 Unknown 225,036,504–225,037,190
GRMZM5G838671 Unknown and/or zinc finger domain 225,094,961–225,096,904
GRMZM2G090559 Unknown and/or ankyrin repeat 225,097,180–225,128,205
GRMZM2G099765 Peptidase C1A 225,156,707–225,158,802
GRMZM2G099862 Unknown and/or DNA binding 225,159,420–225,162,831
GRMZM2G022863 Knottin 225,173,505–225,174,128
GRMZM2G074496 Unknown and/or defense 225,227,431–225,230,275
GRMZM2G074664 NUDIX hydrolase 225,231,579–225,233,724
GRMZM2G460429 Unknown 225,260,736–225,266,407
GRMZM2G139813 Aminotransferase 225,299,360–225,307,593
GRMZM2G448692 Unknown and/or DUF724 225,318,983–225,321,945
GRMZM2G040932 Knottin 225,324,513–225,325,121
GRMZM2G024641 AT hook-like and/or Tudor-like 225,364,989–225,366,192
GRMZM2G426158 Unknown 225,408,728–225,409,852
GRMZM2G055594 Unknown 225,444,080–225,444,896
GRMZM2G055621 Unknown 225,444,309–225,444,896
GRMZM2G355760 Unknown 225,449,048–225,451,754
GRMZM2G458075 Protein kinase-like 225,525,987–225,532,287
GRMZM2G068011 Unknown 225,537,200–225,538,437
GRMZM2G405804 Unknown 225,612,135–225,619,263
GRMZM2G159756 Protein kinase-like 225,647,692–225,652,047
GRMZM2G170161 BSD domain 225,677,900–225,682,490
GRMZM2G470984 Phytosulfokine 225,678,026–225,678,382
GRMZM2G001405 Decarboxylase 225,703,852–225,705,177
GRMZM2G070831 Pre-mRNA processing 225,766,169–225,769,071
GRMZM2G372058 Unknown and/or leucine rich repeat 225,781,716–225,784,625
GRMZM2G372068 UDP glycosyltransferases 225,806,982–225,808,719
GRMZM2G331417 ATP synthase 225,822,494–225,823,126
GRMZM2G577201 Unknown 225,823,425–225,824,871
GRMZM2G007028 Unknown and/or AT hook-like 225,825,290–225,833,496
GRMZM2G135354 Prefoldin 225,851,426–225,853,770
GRMZM2G135314 Unknown 225,854,099–225,855,733
GRMZM2G433731 Unknown 225,857,203–225,861,698
GRMZM2G314940 Unknown 225,937,816–225,938,878
GRMZM2G355185 Unknown 226,017,163–226,020,660
GRMZM2G703402 Unknown 226,024,413–226,025,404
GRMZM2G067713 Unknown 226,050,306–226,052,861
GRMZM2G313110 Unknown 226,178,170–226,179,367
GRMZM2G023652 Unknown and/or Xklp2-like 226,201,724–226,206,198
GRMZM2G457381 DNA binding 226,314,027–226,323,829
GRMZM2G106531 Carotene isomerase 226,366,352–226,371,341
GRMZM2G106604 Unknown and/or DUF593 226,373,905–226,378,075
GRMZM2G106655 Cytochrome P450 226,392,734–226,394,830
GRMZM2G451729 Unknown 226,410,242–226,413,026
GRMZM2G150813 Unknown and/or zinc finger CCHC domain 226,422,679–226,426,851
GRMZM2G083095 Chaperone and/or tailless complex polypeptide 226,447,069–226,451,914
GRMZM2G083599 Glycoside hydrolase 226,452,553–226,454,581
GRMZM5G848516 Unknown 226,557,104–226,557,487
GRMZM2G066394 Pseudouridine synthase 226,585,530–226,586,233
GRMZM2G008854 Kinase-like 227,652,480–227,654,480
GRMZM2G345622 Peptidase S8 226,630,196–226,633,901
GRMZM2G053384 Pentatricopeptide repeat protein 226,676,462–226,678,841
GRMZM2G353343 Unknown 226,679,089–226,680,887
GRMZM2G552706 Unknown 226,690,744–226,691,773
GRMZM2G000936 Tetratricopeptide repeat and/or protein binding 226,699,977–226,705,433
GRMZM2G053713 Protein phosphatase 2C-like 226,963,057–227,123,377
GRMZM2G318412 Unknown and/or homeodomain-like 227,029,696–227,031,991
GRMZM2G450166 Pentatricopeptide repeat protein 227,045,894–227,046,871
AC196106.2_FG001 Unknown and/or C terminal domain of Paramyxovirinae RNA polymerase 227,173,374–227,175,299
GRMZM2G165173 Pentatricopeptide repeat protein 227,209,438–227,212,064
GRMZM2G165216 Unknown and/or kinase-like 227,213,495–227,214,494
GRMZM2G303463 Unknown and/or HLH DNA binding domain 227,264,500–227,268,560
GRMZM2G004521 Kelch motif and/or pentatricopeptide repeat 227,277,639–227,282,413
GRMZM2G303474 Unknown 227,285,977–227,286,612
GRMZM2G081377 Unknown 227,303,145–227,304,513
GRMZM2G552793 Unknown 227,400,943–227,401,440
GRMZM2G145930 Unknown and/or kinase-like 227,516,080–227,537,665
GRMZM2G145916 Unknown 227,539,458–227,539,875
GRMZM2G158308 Pentatricopeptide repeat protein 227,540,645–227,542,487
GRMZM5G857814 Unknown 227,542,645–227,543,218
GRMZM2G158298 Histone H2A 227,544,895–227,545,712
GRMZM2G158288 Nucleic acid-binding proteins and/or OB fold 227,546,551–227,551,614
GRMZM2G158279 Unknown 227,552,200–227,552,975
GRMZM5G847407 Unknown 227,553,873–227,554,031
GRMZM2G458122 Pentatricopeptide repeat-like 227,586,065–227,587,703
GRMZM2G158175 Unknown 227,594,474–227,598,371
GRMZM2G439814 Pentatricopeptide repeat protein 227,599,623–227,600,372
AC215723.3_FG001 Pentatricopeptide repeat protein 227,600,700–227,601,599
GRMZM2G453956 Pentatricopeptide repeat protein 227,604,054–227,608,803
GRMZM2G408216 Unknown and/or peptidase 227,610,560–227,618,077
GRMZM2G108482 Pentatricopeptide repeat-like 227,618,518–227,619,348
GRMZM2G008854 Kinase-like 227,652,480–227,654,480
GRMZM2G104286 Pentatricopeptide repeat protein 227,663,963–227,665,778
GRMZM2G008865 Histone H2A 227,657,388–227,658,767
GRMZM2G116395 Unknown 227,859,648–227,861,492
GRMZM2G416498 Pentatricopeptide repeat protein 227,876,866–227,880,456
GRMZM2G116461 Unknown 227,882,663–227,886,563
GRMZM2G416518 Pentatricopeptide repeat-like 227,893,366–227,895,004
GRMZM2G416541 Unknown 227,929,684–227,931,623
GRMZM2G416544 Histone H2A 227,932,245–227,946,984
GRMZM2G124555 Kinase 227,955,470–227,957,312
GRMZM2G124602 Pentatricopeptide repeat protein 227,958,844–227,962,673
GRMZM2G124616 Unknown and/or peptidase-like 227,964,374–227,971,891
GRMZM2G097511 Histone H2A 228,003,621–228,005,314
GRMZM2G135195 Glycotransferase 228,034,704–228,036,176
GRMZM2G436001 MiaB methiolase 228,040,126–228,050,456
GRMZM2G436001 Methylthiotransferase 228,046,347–228,050,468
GRMZM2G435993 Unknown 228,054,663–228,062,838
GRMZM2G135087 Unknown and/or DUF295 domain 228,064,519–228,066,636
Genes taken from the filtered gene set and coordinates are from MaizeSequence release 5b.60 (Ware et al., 2011; Schnable et al., 2009).
ATP, adenosine triphosphate; mRNA, messenger RNA.
§Sequence coordinates corresponding to MaizeSequence release 5b.60 (Ware et al., 2011; Schnable et al. 2009).
These genes contain the flanking markers for Rf8. Gene GRMZM2G76755 contains the proximal flanking marker while gene GRMZM2G135087 contains the distal flanking marker.
#Genes of particular interest including the 10 predicted pentatricopeptide repeat (PPR)-encoding genes, PPR repeat-like containing genes, a tetratricopeptide repeat (TPR) encoding gene, and an RNA editing gene.

Six PPRs in this region belong to a clade of PPRs that encompass known Rf genes in plants (Akagi et al., 2004; Bentolila et al., 2002; Brown et al., 2003; Desloire et al., 2003; Klein et al., 2005). These genes are GRMZM2G450166, GRMZM2G158308, GRMZM2G439814, GRMZM2G453956, GRMZM2G416498, and GRMZM2G124602. However, GRMZM2G053384 is a PPR-encoding gene in this region that does not belong to the Rf clade (Fujii et al., 2011; I. Small, personal communication, 2010). In addition, GRMZM2G070831 is a pre-mRNA processing factor positioned 910 kbp proximal to the PPRs. Previously cloned Rf genes encode PPR proteins that alter RNA transcript accumulation (with the exception of maize Rf2a). Because Rf8 mediates T-urf13 transcript accumulation and is located in a PPR cluster, it is reasonable to speculate that Rf8 may also be a PPR-encoding gene.

Additional Restorer of Fertility Loci in the whp1 to umc36 Interval

As described above, T-cytoplasm plants segregating for Rf8 accumulate additional 1.42- and 0.42-kbp T-urf13 transcripts. Likewise, plants segregating for Rf1 accumulate additional 1.6- and 0.6-kbp transcripts (Wise et al., 1996) and those segregating for an additional Rf locus, Rf*, accumulate additional 1.40- and 0.40-kbp T-urf13 transcripts (Dill et al., 1997; Wise et al., 1999b). All three of these T-cytoplasm restorers share a small, conserved target sequence in the T-urf13 open reading frame yet independently control the modification of T-urf13 CMS-associated transcripts (Dill et al., 1997). Interestingly, this same target sequence is also highly conserved among sites for Rf*-mediated T-urf13 processing and the CMS-associated orf107 transcript accumulation regulated by sorghum Rf3 (Tang et al., 1996; Wise et al., 1999a).

Since we already identified Rf8-linked DNA markers, we further tested the relationship between Rf8 and the additional partial restorer, Rf*, by testing Rf8-linked markers on segregating progeny of an Rf* mapping population. A population of 88 progeny segregating for Rf* was established using the same procedure used to generate the Rf8 mapping population (see Methods) and the Rf8-linked 144635p4 PCR-based marker was found to be linked to the Rf* locus (Fig. 4).

Figure 4.
Figure 4.

Polymerase chain reaction (PCR) marker 144635p2 illustrating linkage to the Rf* locus. Inbred lines (normal [N]) wx1-m8 and (N) W64A and 17 progeny from the Rf* mapping population were tested for PCR marker 144635p4. The presence or absence of the 1.42- and 0.42-kbp Rf*-associated T-urf13 transcript, as detected by probe T-st308 is given. T, Texas.

 

Having established that Rf* was in the whp1 to umc36 interval on maize chromosome 2L, we performed an additional test to see whether we could directly identify recombinants between Rf8 and Rf*. The experiment was based on RNA blot analysis using two different probes that can differentiate the Rf8 and Rf* specific T-urf13 transcripts. Probe T-st308 hybridizes to the Rf8 specific transcripts (1.42- and 0.42 kbp) as well as the Rf*-specific transcripts (1.40- and 0.40 kbp). The oligo probe CD1721 only hybridizes to the Rf8-specific transcripts (Dill et al., 1997).

An individual heterozygous for Rf* (Rf*-7212/rf*-W64A) was used to pollinate a plant heterozygous for Rf8 (Rf8-8703/rf8-W64A) and a BC1 population was generated by pollination with (N) W64A (rf8/rf8, rf*/rf*). Two BC1 families derived from individuals carrying both Rf8 and Rf* (98 1233 and 98 1236) were identified from 24 planted families via RNA blot analysis in the 1998 summer nursery. A total of 53 individual plants from the two families (12 from 98 1233 and 41 from 98 1236) were analyzed via RNA blot analysis using probes T-st308 and CD1721 (Table 4).


View Full Table | Close Full ViewTable 4.

Chi-square test of the expected and observed outcome of linkage test of Rf8 and Rf*.

 
T-st308
CD1721
Number of progeny accumulating Rf8- and/or Rf*-mediated T-urf13 transcripts
Number of progeny accumulating Rf8- or Rf*-mediated T-urf13 transcripts
Assumptions Rf8 or Rf* rf8 or rf* χ2 Rf8 Rf* χ2
Independent Expected (3:1) 39.7 13.3 17.6 Expected (1:1) 26.5 26.5 0.17
Allelic Expected (1:0) 53 0 0 Expected (1:1) 26.5 26.5 0.17
Observed 53 0 Observed 25 28
Under the assumption of independence, probe T-st308 would detect a 3:1 segregation for the presence of Rf8- and/or Rf*-mediated T-urf13 transcripts (Rf8-8703, Rf*-7212/rf8-W64A, rf*-W64A; Rf8–8703, rf*-W64A/rf8-W64A, rf*-W64A; and rf8-W64A, Rf*-7212/rf8-W64A, rf*-W64A) to the absence of Rf8- and/or Rf*-mediated T-urf13 transcripts (rf8-W64A, rf*-W64A/rf8-W64A, rf*-W64A). Probe CD1721 would detect a 1:1 segregation for the presence of Rf8-mediated T-urf13 transcripts and the presence of Rf*-mediated T-urf13 transcripts (Rf8-8703/rf-W64A or Rf*-7212/rf-W64A). Under the assumption of close linkage or allelism, probe T-st308 would detect presence Rf8- or Rf*-mediated T-urf13 transcripts to the inability to detect the Rf*-mediated T-urf13 transcripts.
Indicates these individuals do not accumulate any restorer of fertility (Rf)-mediated novel T-urf13 transcripts.
§Indicates these individuals accumulate the Rf*-mediated T-urf13 transcripts but cannot be detected by CD1721 probe.

If Rf8 and Rf* are encoded by separate but linked open reading frames, then the BC1 families would be derived from an individual with the genotype Rf8-8703, Rf*-7212/rf8-W64A, rf*-W64A and any of four genotypes could arise (Rf8-8703, Rf*-7212/rf8-W64A, rf*-W64A; rf8-W64A, rf*-W64A/rf8-W64A, rf*-W64A; Rf8-8703, rf*-W64A/rf8-W64A, rf*-W64A; and rf8-W64A, Rf*-7212/rf8-W64A, rf*-W64A). If Rf8 and Rf* are alleles of one locus, the two BC1 families would be derived from an individual with the genotype Rf8-8703/Rf*-7212 and the expected segregation pattern would consist of two genotypes (Rf8-8703/rf-W64A and Rf*-7212/rf-W64A). As described above, plants carrying Rf8 and Rf* can be distinguished by hybridization of RNA gel blots with the T-st308 and CD1721 probes. When hybridized with T-st308, all 53 individuals displayed either the 1.42-kbp or the 1.40-kbp transcripts (χ21:0 = 0 < χ21, 0.05 = 3.84, p value > 0.05). Twenty-five of these individuals hybridized to the 1.42-kbp transcript when hybridized with the probe CD1721, confirming that these individuals contained Rf8. The remaining 28 individuals did not hybridize to the 1.42-kbp transcript when probed with CD1721; this result implies that these progeny do not harbor Rf8 and thus must contain Rf*.

Figure 5 illustrates the accumulation of T-urf13 transcripts in segregating progeny of BC1 families. Panel A shows the expected transcript accumulation detected by the T-st308 and CD1721 probes in different cms-T genotypes. Panel B illustrates the position of these probes on the T-urf13 sequence and the respective splice sites within T-urf13 mediated by each of the different Rf genes (from Dill et al., 1997). Panel C shows that the T-st308 probe hybridizes to all segregating BC1 progeny; thus, they all must carry one or both of the Rf8 or Rf* genes. Panel D illustrates the CD1721 probe hybridizes only to progeny containing the 1.42- and 0.42-kbp transcripts; implying they contain the Rf8 gene. Those individuals not displaying hybridizing transcripts to CD1721 are interpreted as containing Rf*. As shown in Table 4, no double recessive individuals (rf8-W64A/rf8-W64A, rf*-W64A/rf*-W64A, or rf8-W64A/rf*-W64A) were identified among 53 progeny, indicating that Rf8 and Rf* are either alleles of the same locus or tightly linked. To calculate the upper limit of recombination based on 53 progeny, we used the formula (1 − r)53 = α, where r represents the recombination ratio and α represents the type I error level. Based on this formula, the 95% confidence interval for recombination is (0, 0.055).

Figure 5.
Figure 5.

Analysis of progeny from BC1 families segregating for Rf8 and Rf*. Panel A shows the expected transcript accumulation detected by the T-st308 probe, and the CD1721 26nt oligo probe for all Texas (T)-cytoplasm maize (cms-T), Rf1, Rf8, and Rf*, respectively. Panel B shows the position of the probes on the T-urf13 sequence and the respective splice sites mediated by each of the different restorer of fertility (Rf) genes (vertical arrowheads designated as nucleotides from the T-urf13 AUG; from Dill et al., 1997). Panel C illustrates that the T-st308 probe hybridizes to both the 1.42- and 1.40-kbp transcripts in backcross progeny that carry Rf8 or Rf*, respectively, whereas panel D shows that the CD1721 probe only hybridizes to the 1.42-kbp transcript in progeny that carry Rf8 and not the 1.40-kbp transcript mediated by Rf*, thus differentiating the two types of progeny.

 

Transcript Accumulation and Fertility Phenotypes Do Not Cosegregate

Table 5 displays the fertility segregation of the 1997 and 2008 populations. The 2008 population exhibited 151 partially male-fertile plants and 1575 sterile plants while the 1997 population exhibited 44 partially male-fertile and 118 male sterile plants. Previously, Dill et al. (1997) observed that every partially male-fertile individual tested displayed the Rf8-associated transcripts while the sterile plants segregated for the presence of the transcripts. It was also observed that sterile plants exhibiting presence of the transcripts could produce fertile progeny in subsequent generations. Based on these observations, it was concluded that Rf8 is incompletely penetrant. Further complicating these conclusions was the empirical observation that fertility was environmentally sensitive; if the temperature was cool (24–28°C) during tassel development before anthesis, there was a high probability that plants with the potential for fertility would be fertile whereas if the temperature was hot (29–34°C) during the same period, plants with the identical genotype would be sterile (Dill et al., 1997). To further characterize these phenomena in the 2008 population, 126 partially male-fertile plants were genotyped using the tightly linked markers csu811_p9 and umc36_p10. Since it was thought that Rf8 was incompletely penetrant, it was expected that most or all partially male-fertile plants in the 2008 population would carry the dominant Rf8-8703 allele and would be heterozygous (Rf8-8703/rf8-W64A) for the tightly linked genotypic markers. However, the plants displayed a 1:1 segregation (χ21:1 = 0.008; p = 0.93) for these two markers—five were recombinant, 61 were heterozygous (Rf8-8703/rf8-W64A), and 60 were homozygous recessive (rf8-W64A/rf8-W64A).


View Full Table | Close Full ViewTable 5.

Fertility summary of the 1997 and 2008 rf8 mapping population.

 
Progenitor fertility phenotype Number of plants with the indicated phenotypes
Progenitor Progeny rows S “S” Total no. of plants
95 3233-2 “S” 97 2219–97 2226 118 44 166
97 2220-11 “S” 08 7243–08 7247 167 14 183
97 2220-12 “S” 08 7248–08 7250 and 08 7301–08 7302 179 14 194
97 2220-17 S 08 7303–08 7307 117 7 125
97 2220-22 “S” 08 7308–08 7312 147 14 161
97 2221-3 S 08 7313–08 7316 129 32 163
97 2222-15 “S” 08 7327–08 7331 163 25 188
97 2222-3 S 08 7322–08 7326 162 12 174
97 2223-15 “S” 08 7332–08 7336 175 4 179
97 2224-3 “S” 08 7337–08 7341 164 12 176
97 2225-1 S 08 7342–08 7346 172 17 189
2008 Total: 1575 151 1731
Progenitor plants are (Texas [T]) Rf8-8703/rf8-W64A crossed by (normal [N]) rf8-W64A/rf8-W64A. The genotype of all the progenitors was inferred by presence of the 1.42- and 0.42-kbp T-urf13 transcripts.
S, sterile; “S,” partially fertile.

Because a 1:1 genotypic segregation was not expected in the partially fertile plants, we designed an experiment to test the partially fertile and sterile plants for the Rf8-associated transcripts. One hundred eighty plants that were selected based on prior knowledge of their genotype score and fertility phenotype were assayed for presence of Rf8-associated 1.42- and 0.42-kbp T-urf13 transcripts. Table 6 and Fig. 6 show a lack of cosegregation of partially male-fertile and male-sterile plants with and without the Rf8-associated transcripts. Of the 44 partially male-fertile plants, 17 individuals did not contain the 1.42- and 0.42-kbp transcripts while 27 individuals displayed the 1.42- and 0.42-kbp transcripts. Of the 136 male-sterile plants, 48 did not contain the 1.42- and 0.42-kbp transcripts while 88 displayed the transcripts. The findings that partially male fertile individuals are segregating 1:1 for tightly linked markers and at least 17 of these partially male-fertile plants do not display the 1.42- and 0.42-kbp transcripts suggest that fertility restoration could be under the control of an additional unlinked locus. This opens the possibility that fertility and transcript accumulation could be uncoupled and therefore Rf8 would not be incompletely penetrant as postulated previously (Dill et al., 1997). These observations further imply that accumulation of Rf8-associated T-urf13 transcripts is not necessary or sufficient for fertility restoration.


View Full Table | Close Full ViewTable 6.

Segregation of the 1.42- and 0.42-kbp T-urf13 transcripts and partial male fertility.

 
T-urf13 transcript accumulation Number of partially male fertile plants Number of male sterile plants Total
1.42 and 0.42 kbp present 27 88 115
1.42 and 0.42 kbp absent 17 48 65
Total 44 136 180
Plants are a subset of the 2008 mapping population. Plants were chosen for RNA blot analysis based on prior knowledge of their genotype scores and fertility phenotype.
Figure 6.
Figure 6.

Ribonucleic acid (RNA) gel blot of partially male-fertile and -sterile plants showing segregation between fertility and the Rf8-associated 1.42-kbp transcript. The probe is st308, a portion of the T-urf13 gene (Wise et al., 1996). No hybridizing bands are expected on the RNA blot in lanes 1 and 2 because the probe is specific to Texas (T) cytoplasm while the samples are normal (N) cytoplasm. Lane 3 contains the Rf1 control illustrating the 1.6-kbp transcript. Lanes 5 through 14 are partially male fertile with lanes 5 through 9 displaying the 1.42-kbp transcript. Lanes 10 through 14 illustrate the absence of the transcript. Lanes 15 through 23 are male sterile with lanes 15 through 19 demonstrating the 1.42-kbp transcript. Lanes 20 through 23 display the absence of the transcript.

 

Molecular Marker Genotypes in the rf8 Region Segregate as Expected but Fertility Phenotypes Do Not

Individual segregating progeny were assessed for anther exsertion and/or accumulation of the 1.42- and 0.42-kbp T-urf13 transcripts to determine the number of factors responsible for these phenotypes. To test the hypothesis that rf8 is a single locus, tightly linked genotypic markers should segregate 1:1 for heterozygous and homozygous recessive individuals in the Rf8 backcross population, respectively. Table 7 demonstrates that the p value for segregation of the tightly linked PCR marker 66902p1 was greater than 0.05 and therefore not significantly different from a 1:1. All 1997 progenitor plants of the 2008 population displayed the Rf8- associated 1.42- and 0.42-kbp T-urf13 transcripts and were heterozygous for RFLP markers csu811 and umc36. Progeny from one progenitor, 97 2220-22, did not segregate for 66902p1. This could be explained by a crossover occurring at meiosis in the 97 2220-22 plant between 144635p4 and 66902p1. The adjusted population total listed in Table 7 removes these progenies.


View Full Table | Close Full ViewTable 7.

Genotypic segregation of polymerase chain reaction (PCR) marker 66902p1 in the Rf8 population.

 
Number of plants with the indicated 66902p1 score
Progenitor Progeny rows Heterozygous Recessive χ21:1 p value
97 2220-11 08 7243–08 7247 60 67 0.386 0.535
97 2220-12 08 7248–08 7250 and 08 7301–08 7302 33 41 0.865 0.352
97 2220-17 08 7303–08 7307 37 42 0.316 0.574
97 2220-22 08 7308–08 7312 0 121 121.000 0.000
97 2221-3 08 7313–08 7316 34 47 2.086 0.149
97 2222-15 08 7327–08 7331 54 71 2.312 0.128
97 2222-3 08 7322–08 7326 82 67 1.510 0.219
97 2223-15 08 7332–08 7336 61 67 0.281 0.596
97 2224-3 08 7337–08 7341 57 76 2.714 0.099
97 2225-1 08 7342–08 7346 43 51 0.681 0.409
Adjusted total 461 529 4.671 0.792
All progenitor plants were crossed by (normal [N]) W64A to derive the 2008 plants.
Progeny did not segregate for marker 66902p1; however, 76755p2 segregated 47 homozygous to 28 heterozygous; p value = 0.028. This can be explained by a crossover event happing between 144635p4 and 66902p1 during meiosis in plant 97 2220-22.
§Total reported is excluding progeny of 97 2220-22, which did not segregate for 66902p1. Eight degrees of freedom were used to calculate the adjusted total p value.

Dill et al. (1997) reported environmental sensitivity in Rf8 plants. Greater anther exsertion is observed at lower temperatures while less is observed at higher temperatures. Segregation for fertility categories in the 2008 mapping population is reported in Table 5. This population displayed a ratio of 1:10 (χ2 1:10 = 0.244; p = 0.62) partially fertile to sterile plants. This ratio does not align with the hypothesis of one, two, three, or four completely dominant independently assorting genes; however, flowering is a complex process and other phenomena are likely. A 1:10 ratio lies between a three-gene test cross (1:7) and a four-gene test cross (1:15). Linkage, additivity, epistatis, or incomplete dominance could be involved in skewing a standard ratio to 1:10.

Effect of Genetic Background on Rf8-Mediated Fertility

The observation was made from 1994 to 2000 that fertility of plants carrying Rf8 decreased with each successive generation backcrossed to (N) rf8-W64A/rf8-W64A. Starting in 2000, plants were crossed by (N) wx1-m8 in addition to (N) W64A (see Fig. 1) to test if the wx1-m8 background would increase fertility compared to (N) W64A. As shown in Table 8, five generations were observed for fertility in our 2009 summer Ames, IA, nursery. When backcrossed to (N) W64A, fertility decreased whereas crossing to (N) wx1-m8 increased fertility. A subset of the plants that displayed fertility, including the one partially male-fertile plant from the BC4 cross, were used as pollen donors and seed was obtained, demonstrating their fertility. The generations tested generally displayed the expected trend of increased fertility with greater amounts of (N) wx1-m8 in the pedigree as opposed to (N) W64A. This is suggestive of other factors involved in fertility present in the background of (N) wx1-m8 yet absent in the background of (N) W64A.


View Full Table | Close Full ViewTable 8.

Phenotypic ratios associated with various amounts of backcrossing.

 
Parental genotype Pollen donor Parental fertility phenotype Parental transcript accumulation 2009 progeny rows Number of plants with the indicated phenotypes
Total no. of plants
Cross S “S” “F”
08 7330-1 × 7319 BC4 (N) W64A S 1.42 and 0.42 present 8132, 8136, 8147, and 8148 53 1 0 54
01 4136-4 × 4018 BC6TC1 (N) W64A “S” 1.42 and 0.42 present 8123, 8126, 8130, and 8145 23 20 11 54
02 5230-21 × 5229-3 BC6TC2 (N) wx1-m8 “S” 1.42 and 0.42 present 8131, 8141, 8146, and 8150 8 18 22 48
00 3437-1 × 3446 BC5TC1 (N) wx1-m8 NA 1.42 and 0.42 present 8124, 8133, 8140, and 8142 7 23 17 47
01 4136-3 × 4149 BC5TC2 (N) wx1-m8 “S” 1.42 and 0.42 present 8135, 8137, 8139, and 8144 13 20 2 35
Crosses are diagrammed in Fig. 1 and were planted in 2009.
N, normal. Pollen donor lines, which correspond to the second plant number in the Cross column, are listed.
§S, sterile; “S,” partially fertile; “F,” mostly fertile.
Parental fertility phenotype not available (NA).

Delay of Fertility in Partially Male-Fertile Plants

In addition to the genetic background affecting the amount of fertility in Rf8 plants, the timing of anther exsertion influences the degree of fertility observed. To test if mostly male-fertile plants flower earlier than partially male-fertile plants, five generations were grown and observed in 2009. All plants were observed daily for exsertion of anthers. Four generations, BC5TC1, BC5TC2, BC6TC1, and BC6TC2, segregated for three of the fertility categories: sterile, partially male fertile, and mostly male fertile. As shown in Table 9, the average days after planting to the first flowering (DAPFF) was calculated for all cross types, with DAPFF defined as the first day an exserted plump yellow anther was observed. A two-tailed paired t test was used to calculate significance between flowering time of partially fertile and mostly fertile plants. Within a given genotype, all mostly male-fertile plants showed a significantly earlier DAPFF of flowering than the partially male-fertile plants. Flowering in 2009 was delayed by 3.7 to 2.4 d depending on the genotype. These results suggest that there may be other factors responsible for flowering time segregating in the partially fertile and mostly fertile plants.


View Full Table | Close Full ViewTable 9.

Average days after planting to the first flowering (DAPFF) in partially male-fertile and mostly male-fertile plants.

 
Genotype Phenotype Average DAPFF p value
BC5TC1 Mostly fertile 63.9 0.0014**
Partially fertile 67.3
BC5TC2 Mostly fertile 67.5 0.0092**
Partially fertile 70.0
BC6TC1 Mostly fertile 66.5 0.0030**
Partially fertile 68.9
BC6TC2 Mostly fertile 65.4 0.0113**
Partially fertile 68.1
**Significant at the 0.01 probability level.
Mostly male-fertile plants flowered significantly earlier than partially male-fertile plants of a given genotype.


Discussion

rf8 is Positioned in a 4.55-Mbp Region on Maize 2L

Cytoplasmic male sterility systems have been established as models for studying nuclear-cytoplasmic interactions. This is because restoration of fertility depends on nuclear-encoded gene products to overcome mitochondrial dysfunction. Genetic and physical mapping of Rf loci with easily assayable molecular markers is a step toward the physiological understanding of fertility restoration because individual factors can then be tracked in the progeny of various crosses. An important factor to the success of this genetic mapping was the use of the T-urf13 transcript phenotype as opposed to the fertility phenotype. This allowed us to observe the uncoupling of the fertility from the transcript accumulation pattern. These experiments demonstrate that gene mediating the Rf8-associated T-urf13 accumulation pattern is located in the 4.55-Mbp region on 2L between PCR markers 76755p2 and 135087p1, corresponding to contig 108 in MaizeSequence release 5b.60 (Ware et al., 2011).

Dill et al. (1997) reported that Rf8 was incompletely penetrant based on fertility data and transcript accumulation of 79 individuals. All partially male-fertile plants in that particular study accumulated the 1.42- and 0.42-kbp T-urf13 transcripts. However, the results reported here demonstrate that partially male-fertile individuals in the 2008 mapping population segregate 1:1 for tightly linked genotypic markers and 17 of these did not display the Rf8-associated transcripts. Thus, the current results are not congruent with the interpretation of incomplete penetrance reported by Dill et al. (1997). The locus designated Rf8 on maize chromosome 2L appears to control transcript accumulation, while fertility appears to be at least partially controlled by additional factors. Given the existence of partially male–fertile individuals without the 1.42- and 0.42-kbp transcripts and male-sterile individuals with the 1.42- and 0.42-kbp transcripts, transcript presence does not appear to be necessary or sufficient for fertility restoration. This could indicate the presence of at least one other factor in the genome responsible for partial fertility restoration. One could postulate that other RF2-like aldehyde dehydrogenase (ALDH) proteins affect fertility; however, the Rf2a allele was fixed and homozygous in these populations. Nevertheless, there are other segregating Rf2 family members, that is, Rf2b, Rf2c, and Rf2d, encoding functional ALDH proteins (Skibbe et al., 2002), which may be contributing to anther exsertion.

To test the hypothesis that genetic background affects fertility, five generations of Rf8 plants were grown in 2009. The fertility observations suggest a difference in the backgrounds of W64A and wx1-m8 because plants reintroduced with wx1-m8 displayed greater fertility. This could be interpreted as wx1-m8 harboring other unlinked genes favorable to fertility that W64A does not possess. To test for differences between partially fertile and mostly fertile plants, the DAPFF was recorded. This demonstrated that partially fertile plants flower significantly later than mostly fertile plants. This suggests the presence of other factors segregating for the timing of flowering.

Clusters of Linked Restorer of Fertility Genes are Conserved across Plant Taxa

Fine mapping of ZmRf8 (T cytoplasm) as well as ZmRf3 (S cytoplasm) suggest that both genes map to the same cluster of PPR genes on 2L. As illustrated in Table 10, the phenomenon of linked restorer genes is not unique to maize. Rice contains a PPR cluster spanning 450 kbp on chromosome 10L that contains six Rf genes that restore four different cytoplasms (Tan et al., 2011). OsRf4 and OsqRf-10-2 restore wild abortive (WA) and dwarf abortive (DA) cytoplasm, respectively, which are characterized by sporophytic restoration (Xie et al., 2002; Yao et al., 1997). OsRf1a and OsRf1b restore Boro II (BT) cytoplasm, whereas OsRf5 and OsRf6 restore Honglian (HL) cytoplasm (Akagi et al., 2004; Komori et al., 2004; Liu et al., 2004; Wang et al., 2006). Both BT and HL cytoplasms are characterized by gametophytic restoration. In this way, the rice 10L locus is analogous to the maize 2L locus. Both species contain linked Rf genes capable of restoring cytoplasms with different modes of restoration. Similar to rice and maize, cotton (Gossypium hirsutum L.) has two linked Rf genes, GhRf1 and GhRf2. These genes restore two different cytoplasms that also utilize different modes of restoration: D2 cytoplasm uses sporophytic restoration by GhRf1 whereas D8 cytoplasm uses gametophytic restoration via GhRf2 (Meyer, 1975; Zhang and Stewart, 2001). Two studies have mapped these genes within 1 cM of each other (Wang et al., 2007, 2009). Likewise, common bean (Phaseolus vulgaris L.) contains two linked fertility restorer genes, PvFr and PvFr2, on linkage group K (He et al., 1995; Jia et al., 1997). Sorghum, a close relative of maize, contains PPR clusters around its unlinked Rf genes. SbRf1, SbRf2, and SbRf5 reside in a cluster of five, four, and seven PPR-encoding genes, respectively (Jordan et al., 2011). The PPR-encoding genes within these clusters display high similarity, and the clusters around SbRf2 and SbRf5 show high similarity to rice OsRf1 (Jordan et al., 2011). Thus, precedent exists for linked Rf genes to exist in one PPR cluster capable of restoring multiple cytoplasms characterized by various modes of restoration.


View Full Table | Close Full ViewTable 10.

Comparisons of species and their fertility restorer genes.

 
Cytoplasm Mode of restoration Restorer genes Gene location Reference
Oryza sativa L. (rice) WA Sporophytic OsRf4 10L Yao et al., 1997
DA Sporophytic Osq-Rf-10-2 10L Xie et al., 2002
BT Gametophytic OsRf1a, OsRf1b 10L Akagi et al., 2004; Komori et al., 2004; Wang et al., 2006
HL Gametophytic OsRf5, OsRf6 10L Liu et al., 2004
Zea mays L. (maize) T Sporophytic ZmRf1 3 Schnable and Wise, 1994
ZmRf2 9S Schnable and Wise, 1994
ZmRf8, ZmRf* 2L Pei, 2000
S Gametophytic ZmRf3 2L Kamps and Chase, 1997; Xu et al., 2009
Gossypium hirsutum L. (cotton) D2 Sporophytic GhRf1 D5 Meyer, 1975; Wang et al., 2007; Wang et al., 2009;
D8 Gametophytic GhRf2 D5 Zhang and Stewart, 2001
Sorghum bicolor (L.) Moench (sorghum) A1 Sporophytic SbRf1 SBI-08L Klein et al., 2005
SbRf2 SBI-02 Jordan et al., 2010
SbRf5 SBI-05 Jordan et al., 2011
Brassica napus L. (canola) Ogura Sporophytic BnRfo CN19 Brown et al., 2003; Feng et al., 2009
Petunia ×atkinsiana (Sweet) D. Don ex W. H. Baxter (petunia) RM Gametophytic Phrf-PPR592 4 Bentolila et al., 2002; Bentolila et al., 1998
Phaseolus vulgaris L. (bean) Sprite NA PvFr, PvFr2 K He et al., 1995; Jia et al., 1997
Helianthus annuus L. (sunflower) PET1 Sporophytic HaRf1 13 Yue et al., 2010
BT, Boro II; DA, dwarf abortive; HL, Honglian; RM, Rosy Morn; S, USDA; T, Texas; WA, wild abortive.
Three research groups cloned this gene in the same time frame and assigned different names. Brown et al. (2003) named it Rfo, Koizuka et al. (2003) named it orf687, and Desloire et al. (2003) named it Ppr-B. For simplicity, this manuscript refers to it as BnRfo.
§NA, not available. The Fr-mediated restoration of bean is permanent. The presence of Fr causes the permanent elimination of the mitochondrial sterility-associated gene pvs from reproductive tissue (He et al., 1995).

Canola (Brassica napus L.) and petunia contain Rf genes present in PPR clusters containing only one known Rf gene and multiple pseudogenes. BnRfo of canola is located in a cluster with two other PPR-encoding genes (Brown et al., 2003; Feng et al., 2009). Phrf-PPR592 of petunia is adjacent to another PPR gene, PhPPR591 (Bentolila et al., 2002; Bentolila et al., 1998). The nonrestoring allele of Phrf-PPR592 contains a promoter deletion and most likely a recombination event involving similar PPR genes (Bentolila et al., 2002). Currently, it is unknown if sunflower (Helianthus annuus L.) contains linked Rf genes residing in a PPR cluster. HaRf1 restores PET1 cytoplasm in sunflower; however, the landscape of this fertility locus needs to be elucidated (Yue et al., 2010).

The mapping of ZmRf8 in this study places it in or near a PPR cluster on 2L, tightly linked to PCR marker 135087p1 (Fig. 2 and Table 3). Mapping of ZmRf3 for cms-S positions ZmRf3 4.3 cM distal to whp1 (Kamps and Chase, 1997). Further investigations of the whp1 region revealed a cluster of rice OsRf1-orthologus PPR genes in B73 (Xu et al., 2009). This is the same PPR cluster to which ZmRf8 maps. It is therefore reasonable to postulate that ZmRf3 and ZmRf8 reside in the same cluster of PPR-encoding genes.

The molecular phenotype of ZmRf8 is the accumulation of the additional 1.42- and 0.42-kbp T-urf13 transcripts. Pentatricopeptide repeat proteins mediate organelle promoter recognition and RNA editing and translation, processes that could alter patterns of transcript accumulation. For example, maize PPR10 defines both 5′ and 3′ transcript termini simply by site-specific RNA binding and thus does not mediate RNA processing directly (Pfalz et al., 2009; Prikryl et al., 2011). Thus, PPR-encoding genes are the most promising candidates for Rf8, based on previous cloned Rf genes and the pattern of T-urf13 transcript accumulation.

Fujii et al. (2011) identified Rf-like PPR genes in many species. There are five Rf-like-identified genes in the maize B73 genome. Finer mapping in the region containing the PPR-encoding genes could elucidate whether ZmRf3 and ZmRf8 map to the same Rf-like PPR encoding gene. If ZmRf3 and ZmRf8 are alleles, this would be one of the first Rf genes with alleles capable of restoring two different types of cytoplasm with different modes of restoration. Even if they are not alleles, these loci will provide insight into the evolution of CMS and Rf systems. Clearly, this complex locus is a hotspot for fertility restoration.

Acknowledgments

The authors recognize Karin Werner and Greg Fuerst for expert technical assistance in the maize nursery and for nucleic acid isolation and analysis. Also, the authors thank Ian Small for valuable PPR informatics data before publication. This research was supported by USDA-National Research Initiative (NRI) grant nos. 99-35300-7752 and 2002-35301-12064. This article is a joint contribution of The Iowa Agriculture and Home Economics Experiment Station and the Crop and Insect Genetics, Genomics, and Informatics Research Unit, USDA-Agricultural Research Service. Mention of trade names or commercial products in this publication is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the U.S. Department of Agriculture.

 

References

Footnotes


Comments
Be the first to comment.



Please log in to post a comment.
*Society members, certified professionals, and authors are permitted to comment.